New Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA Evidence Supports Multiregional Evolutionary Model?
by Rich Deem

Introduction

Multiregional Evolutionary Theory?

Contrary to the claims of a recent study, the multiregional model, which states that modern humans evolved from several different groups of hominids (including Neanderthals) that interbred at some point to produce modern humans, fails to explain the genetics seen in modern humans, Neanderthals, and early modern humans. The biblical model (stating that humans arose from one lineage from a single geographic location) still fits all the data better than the multiregional model.

Rich Deem

Two theories explaining the origin of humans are popular today among evolutionists. The multiregional model states that modern humans evolved from several different groups of hominids (including Neanderthals) that interbred at some point to produce modern humans. The most widely supported theory states that modern humans arose from a single geographic location from one lineage. This theory, although evolutionary in nature, is similar the biblical creation model. The authors of a new study out from "Down Under" (Australia) claim that they have data supporting the multiregional model.

However, previous anatomical studies have cast doubt on the likelihood of Neanderthals being the ancestors of modern humans (1-5). These studies showed differences in Neanderthal's hands (1), the brain case (2), and numerous other features of the Neanderthal skull (3-5). Recent genetic studies comparing the hypervariable (subject to a higher than average A permanent structural alteration in DNA, consisting of either a substitution, insertion or deletion of nucleotide bases.mutation rate than usual) region of Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA of Neanderthals to that of modern humans, suggest that they were probably a separate species from modern humans (6-8). What has been missing from the previous studies is a comparison of differences between the genetic The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence of living humans compared to ancient, anatomically modern humans.

Ancient Anatomically Modern Aussies

The first study examining the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences of ancient humans (10 anatomically modern Australians) was published in early 2001 (9). Most of the ancient Australians were dated at less than 10,000 years old. However, one specimen was dated at 40,000 years old (redated from the original estimate of 62,000 years old, 10), which means that this person lived before the Neanderthals that have already been Determining the order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequenced. A summary of the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence differences of this individual (compared with the modern human reference The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, modern Aboriginal humans, Neanderthals, and chimpanzees) can be found in the table, below. The first thing that one notices is that the The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence variation of the ancient Australian compared to modern humans is only 10 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs. Previous studies have shown that the average variation among population groups of modern humans is 8 base pairs (the difference between humans and Neanderthals is 26 Two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds.base pairs, by comparison). The exciting thing for those who believe in the creation model is that the difference between the ancient Australian and Neanderthals included only three shared bases. These results demonstrate that the human All the DNA contained in an organism or a cell, which includes both the chromosomes within the nucleus and the DNA in mitochondria.genome was already nearly "modern" before Neanderthals died out.

The authors of the study made a big deal about the ancient Australian The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence sharing similarity to a portion of One of the threadlike "packages" of genes and other DNA in the nucleus of a cell. Different kinds of organisms have different numbers of chromosomes. Humans have 23 pairs of chromosomes, 46 in all: 44 autosomes and two sex chromosomes. Each parent contributes one chromosome to each pair, so children get half of their chromosomes from their mothers and half from their fathers.chromosome 11 in modern humans (thought to have been inserted into the human All the DNA contained in an organism or a cell, which includes both the chromosomes within the nucleus and the DNA in mitochondria.genome from the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA). The authors concluded that the "loss" of the ancient Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA variation seen in ancient Australian could explain how Neanderthals do not share Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA with modern humans. Although it is certainly possible that part of Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA might find its way into nuclear Threadlike "packages" of genes and other DNA in the nucleus of a cell. Different kinds of organisms have different numbers of chromosomes. Humans have 23 pairs of chromosomes, 46 in all: 44 autosomes and two sex chromosomes. Each parent contributes one chromosome to each pair, so children get half of their chromosomes from their mothers and half from their fathers.chromosomes, it doesn't address the issue of how the variation seen in the Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA of ancient Australian was "lost." In fact, of the ten The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence differences between the ancient Australian and the modern human reference The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence, five of those bases correspond to natural variations found in modern Aboriginal people, showing that those five bases were not lost at all. This leaves only a five base difference, certainly within the range of variation found among modern humans. The authors' contention that an ancient humans The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequence was "lost" is not supported by their data, since the introduction of 5 Permanent structural alterations in DNA, consisting of either substitutions, insertions or deletions of nucleotide bases.mutations over a period of 40,000 years is not unreasonable, but would, in fact, be expected in the region of Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA that is subject to a high A permanent structural alteration in DNA, consisting of either a substitution, insertion or deletion of nucleotide bases.mutation rate. Overall, the lack of "evolution" for humans over the last 40,000 years stands in sharp contrast to the large differences seen between modern humans and Neanderthals over the same period of time.

Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA Sequence Variation of Ancient, Anatomically Modern Humans(9)
Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA Sample
(HVR-1)
Age
(ka)
Sequence Number (Read Down)
00111111111111111222222222222222222222222222233333333333333
79001122345668889001223344444555566677888899901112345556688
83781269984393499198340413479368923448467803911780715672817
Modern Human 0 ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA
Aboriginal 0 ......CA......TC..CTT...T.....TC..CTA...T.T.G.C..TT.TC.C...
Chimpanzee 0 ....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C..
Neanderthal #1 30+ GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C...
Ancient Aussie 62 ....................T.G...........CT.T....T..T......TC....G

Addendum

A follow-up article on the claims of Adcock et al. appeared in the journal Science in June, 2001.11 In this rebuttal, European evolutionists came to the same conclusions presented here - that the conclusions of Adcock et al. were unwarranted and actually contradicted by the data. They disputed the claim that these ancient anatomically modern humans were genetically separated from modern humans, saying, "These trees show that LM3 and KS8 are well within modern human variation..." These evolutionists came to the same conclusions as myself, as seen in their final comments:

Lastly, even if the problems with both the data and the analysis were ignored, the phylogenetic tree of Adcock et al. would not support the "multiregional model" for modern human origins, because all the modern human The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences are closely related to each other, whereas the Neandertal The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences form an outgroup. Consequently, to see the data of Adcock et al. as a significant problem for the Out of Africa model seems an exaggerated claim.11

More genetic studies

Recently, proponents of this theory have claimed that fossils show that an archaic Homo erectus from Java shared key features with living Asians and early modern humans in Australia. Their conclusion was that Asian H. erectus passed on some of its Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA to modern Australians and Asians (Science, 12 January 2001, p. 293). A recent genetic analysis of Asians, however, explodes this theory.12 The study, examining more than 1000 Asian men, determined that all of these men came from one source, between 35,000 and 89,000 years ago. The study is so convincing that some multiregional evolutionists have now dropped this theory. At the annual meeting of physical anthropologists in Kansas City, Missouri, one self-described "dedicated multiregionalist," Vince Sarich of the University of California, Berkeley, admitted: 

"I have undergone a conversion--a sort of epiphany. There are no old Y chromosome lineages [in living humans]. There are no old Genetic material found in mitochondria, the organelles that generate energy for the cell.mtDNA lineages. Period. It was a total replacement."

Recent Find in Asia

A miniature hominin, named Homo floresiensis, only 1 meter tall with a brain capacity only 20% of modern humans, has further discredited the multiregional hypothesis. This creature is so unlike any other hominins that it could not have contributed to our All the DNA contained in an organism or a cell, which includes both the chromosomes within the nucleus and the DNA in mitochondria.genome:

"Palaeoanthropological and genetic studies have already done much to discredit this model, and H. floresiensis puts yet another (the last?) nail in the multiregional coffin. Not only did H. floresiensis evolve in the absence of The functional and physical unit of heredity passed from parent to offspring. Genes are pieces of DNA, and most genes contain the information for making a specific protein.gene exchange with other hominins, but no one can argue that LB1 contributed to our own species' genetic make-up."13


Who Was Adam?: A Creation Model Approach to the Origin of ManWho Was Adam?: A Creation Model Approach to the Origin of Man. Are humans just advanced apes or have they been specially created in the image of God? Publications by scientists almost never ask the question, whereas publications by theists seldom examine the scientific data that relates to the question. However, two scientists raised in non-Christian homes, Fuz Rana (Ph.D. in chemistry) and Hugh Ross (Ph.D. in astronomy), have written a new book (Who Was Adam?: A Creation Model Approach to the Origin of Man) that examines the question of human origins by comparing biblical and evolutionary models.


References Top of page

  1. Franzen JL, P.D. Gingerich, J. Habersetzer, J.H. Hurum, W. von Koenigswald, and B.H. Smith BH. 2009. Complete Primate Skeleton from the Middle Eocene of Messel in Germany: Morphology and Paleobiology. PLoS ONE 4(5): e5723. doi:10.1371/journal.pone.0005723.
  2. Seidler H, Falk D, Stringer C, Wilfing H, Muller GB, zur Nedden D, Weber GW, Reicheis W, and Arsuaga JL. 1997. A comparative study of stereolithographically modeled skulls of Petralona and Broken Hill: implications for future studies of middle Pleistocene hominid evolution. J. Hum. Evol. 33:691-703.
  3. Schwartz, J.A. and I. Tattersall. 1996. Significance of some previously unaccompanied apomorphies in the nasal region of Homo neandertalensis. Proceedings of the National Academy of Science USA 93: 10852-10854.
  4. Laitman, J.T.,  J.S. Reidenberg, S. Marquez, and P. J. Gannon. 1996. What the nose knows: New understandings of Neanderthal upper respiratory tract specializations. Proceedings of the National Academy of Science USA 93: 10543-10545.
  5. Holden, C. 1999. A New Look Into Neandertals' Noses. Science 285: 31-33.
  6. Krings, M., A. Stone, R. W. Schmitz, H. Krainitzki, M. Stoneking, and S. Paabo. 1997. Neandertal Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA Sequences and the Origin of Modern Humans. Cell 90: 19-30.
  7. Igor V. Ovchinnikov, I.V., A. Gotherstrom, G. P. Romanovak, V. M. Kharitonov, K. Liden, and W. Goodwin. 2000. Molecular analysis of Neanderthal Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA from the northern Caucasus. Nature 404: 490-493.
  8. Krings, M., C. Capelli, F. Tschentscher, H. Geisert, S. Meyer, A. von Haeseler, K. Grossschmidt, G. Possnert, M. Paunovic, and S. P��bo. 2000. A view of Neandertal genetic diversity Nature Genetics 26: 144-146.
  9. Adcock, G.J., E.S. Dennis, S. Easteal, G.A. Huttley, L.S. Jermiin, W.J. Peacock, and A. Thorne. 2001. Of or referring to the mitochondria, the organelles that generate energy for the cell.Mitochondrial Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA The order of nucleotides in a DNA or RNA molecule, or the order of amino acids in a protein molecule.sequences in ancient Australians: Implications for modern human origins. Proceedings of the National Academy of Science USA 98: 537-542.
  10. Bowler, J. M., Johnston, H., Olley, J. M., Prescott, J. R., Roberts, R. G., Shawcross, W., and Spooner, N. A. 2003. New ages for human occupation and climatic change at Lake Mungo, Australia. Nature 421: 837-840.
  11. Cooper, A., A. Rambaut, V. Macaulay, E. Willerslev, A. J. Hansen, and C. Stringer. 2001. Human Origins and Ancient Human Deoxyribonucleic acid: the chemical inside the nucleus of a cell that carries the genetic instructions for making living organisms.DNA. Science 292: 1655-1656.
  12. Gibbons, A. 2001. Modern Men Trace Ancestry to African Migrants. Science 292: 1051-1052.
    Yuehai Ke, et al. 2001. African Origin of Modern Humans in East Asia: A Tale of 12,000  One of the two sex chromosomes that determines maleness in mammals, carried and passed down from males to males.Y chromosomes. Science 292: 1151-1153.
  13. Lahr, M. M. and R. Foley. 2004. Human evolution writ small. Nature 431: 1043-1044.

http://www.godandscience.org/evolution/multiregional.html
Last Modified November 5, 2004

 

Rich's Blog